Antibodies
Anti-BTK Antibody-Oligo Conjugate
SKU: aoc1361
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BTK Antibody-IF1
Antibody Target
- Target
- Tyrosine-protein kinase BTK
- UniProt Number
- Q06187
- Target Description
- Non-receptor tyrosine kinase indispensable for B lymphocyte development, differentiation and signaling (PubMed:19290921). Binding of antigen to the B-cell antigen receptor (BCR) triggers signaling that ultimately leads to B-cell activation (PubMed:19290921). After BCR engagement and activation at the plasma membrane, phosphorylates PLCG2 at several sites, igniting the downstream signaling pathway through calcium mobilization, followed by activation of the protein kinase C (PKC) family members (PubMed:11606584). PLCG2 phosphorylation is performed in close cooperation with the adapter protein B-cell linker protein BLNK (PubMed:11606584). BTK acts as a platform to bring together a diverse array of signaling proteins and is implicated in cytokine receptor signaling pathways (PubMed:16517732, PubMed:17932028). Plays an important role in the function of immune cells of innate as well as adaptive immunity, as a component of the Toll-like receptors (TLR) pathway (PubMed:16517732). The TLR pathway acts as a primary surveillance system for the detection of pathogens and are crucial to the activation of host defense (PubMed:16517732). Especially, is a critical molecule in regulating TLR9 activation in splenic B-cells (PubMed:16517732, PubMed:17932028). Within the TLR pathway, induces tyrosine phosphorylation of TIRAP which leads to TIRAP degradation (PubMed:16415872). BTK also plays a critical role in transcription regulation (PubMed:19290921). Induces the activity of NF-kappa-B, which is involved in regulating the expression of hundreds of genes (PubMed:19290921). BTK is involved on the signaling pathway linking TLR8 and TLR9 to NF-kappa-B (PubMed:19290921). Acts as an activator of NLRP3 inflammasome assembly by mediating phosphorylation of NLRP3 (PubMed:34554188). Transiently phosphorylates transcription factor GTF2I on tyrosine residues in response to BCR (PubMed:9012831). GTF2I then translocates to the nucleus to bind regulatory enhancer elements to modulate gene expression (PubMed:9012831). ARID3A and NFAT are other transcriptional target of BTK (PubMed:16738337). BTK is required for the formation of functional ARID3A DNA-binding complexes (PubMed:16738337). There is however no evidence that BTK itself binds directly to DNA (PubMed:16738337). BTK has a dual role in the regulation of apoptosis (PubMed:9751072). Plays a role in STING1-mediated induction of type I interferon (IFN) response by phosphorylating DDX41 (PubMed:25704810)..
- Molecular Weight
- 76 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC0485
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse