Antibodies
Anti-BTK Antibody-Oligo Conjugate
SKU: aoc1361
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-BTK Antibody-IF1
Antibody Target
- Target
- Tyrosine-protein kinase BTK
- UniProt Number
- Q06187
- Target Description
- Non-receptor tyrosine kinase indispensable for B lymphocyte development, differentiation and signaling. Binding of antigen to the B-cell antigen receptor (BCR) triggers signaling that ultimately leads to B-cell activation. After BCR engagement and activation at the plasma membrane, phosphorylates PLCG2 at several sites, igniting the downstream signaling pathway through calcium mobilization, followed by activation of the protein kinase C (PKC) family members. PLCG2 phosphorylation is performed in close cooperation with the adapter protein B-cell linker protein BLNK. BTK acts as a platform to bring together a diverse array of signaling proteins and is implicated in cytokine receptor signaling pathways. Plays an important role in the function of immune cells of innate as well as adaptive immunity, as a component of the Toll-like receptors (TLR) pathway. The TLR pathway acts as a primary surveillance system for the detection of pathogens and are crucial to the activation of host defense. Especially, is a critical molecule in regulating TLR9 activation in splenic B-cells. Within the TLR pathway, induces tyrosine phosphorylation of TIRAP which leads to TIRAP degradation. BTK also plays a critical role in transcription regulation. Induces the activity of NF-kappa-B, which is involved in regulating the expression of hundreds of genes. BTK is involved on the signaling pathway linking TLR8 and TLR9 to NF-kappa-B. Acts as an activator of NLRP3 inflammasome assembly by mediating phosphorylation of NLRP3. Transiently phosphorylates transcription factor GTF2I on tyrosine residues in response to BCR. GTF2I then translocates to the nucleus to bind regulatory enhancer elements to modulate gene expression. ARID3A and NFAT are other transcriptional target of BTK. BTK is required for the formation of functional ARID3A DNA-binding complexes. There is however no evidence that BTK itself binds directly to DNA. BTK has a dual role in the regulation of apoptosis. Plays a role in STING1-mediated induction of type I interferon (IFN) response by phosphorylating DDX41.
- Molecular Weight
- 76 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC0485
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse