Antibodies
Anti-Bub3 Antibody-Oligo Conjugate
SKU: aoc1364
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Bub3 Antibody-IF1
Antibody Target
- Target
- Mitotic checkpoint protein BUB3
- UniProt Number
- O43684
- Target Description
- Has a dual function in spindle-assembly checkpoint signaling and in promoting the establishment of correct kinetochore-microtubule (K-MT) attachments. Promotes the formation of stable end-on bipolar attachments. Necessary for kinetochore localization of BUB1. Regulates chromosome segregation during oocyte meiosis. The BUB1/BUB3 complex plays a role in the inhibition of anaphase-promoting complex or cyclosome (APC/C) when spindle-assembly checkpoint is activated and inhibits the ubiquitin ligase activity of APC/C by phosphorylating its activator CDC20. This complex can also phosphorylate MAD1L1..
- Molecular Weight
- 37kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1318
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat