Antibodies
Anti-c-Myc Antibody-Oligo Conjugate
SKU: aoc1699
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-c-Myc Antibody-PLA1
Antibody Target
- Target
- Myc proto-oncogene protein
- UniProt Number
- P01106
- Target Description
- Transcription factor that binds DNA in a non-specific manner, yet also specifically recognizes the core sequence 5'-CAC[GA]TG-3' (PubMed:24940000, PubMed:25956029). Activates the transcription of growth-related genes (PubMed:24940000, PubMed:25956029). Binds to the VEGFA promoter, promoting VEGFA production and subsequent sprouting angiogenesis (PubMed:24940000, PubMed:25956029). Regulator of somatic reprogramming, controls self-renewal of embryonic stem cells (By similarity). Functions with TAF6L to activate target gene expression through RNA polymerase II pause release (By similarity). Positively regulates transcription of HNRNPA1, HNRNPA2 and PTBP1 which in turn regulate splicing of pyruvate kinase PKM by binding repressively to sequences flanking PKM exon 9, inhibiting exon 9 inclusion and resulting in exon 10 inclusion and production of the PKM M2 isoform (PubMed:20010808)..
- Molecular Weight
- 51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBELISAChIPCUT&Tag
- Clone
- ARC0412
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human