Antibodies

Anti-C3 Antibody-Oligo Conjugate

SKU: aoc1369

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-C3 Antibody-IF1

Antibody Target

Target
Complement C3
UniProt Number
P01024
Target Description
Precursor of non-enzymatic components of the classical, alternative, lectin and GZMK complement pathways, which consist in a cascade of proteins that leads to phagocytosis and breakdown of pathogens and signaling that strengthens the adaptive immune system.; FUNCTION: [Complement C3b]: Non-enzymatic component of C5 convertase. Generated following cleavage by C3 convertase, it covalently attaches to the surface of pathogens, where it acts as an opsonin that marks the surface of antigens for removal. Complement C3b binds covalently via its reactive thioester, to cell surface carbohydrates or immune aggregates. Together with complement C4b, it then recruits the serine protease complement C2b to form the C5 convertase, which cleaves and activate C5, the next component of the complement pathways. In the alternative complement pathway, recruits the serine protease CFB to form the C5 convertase that cleaves and activates C5.; FUNCTION: [C3a anaphylatoxin]: Mediator of local inflammatory process released following cleavage by C3 convertase. Acts by binding to its receptor, C3AR1, activating G protein-coupled receptor signaling, promoting the phosphorylation, ARRB2-mediated internalization and endocytosis of C3AR1. C3a anaphylatoxin stimulates the activation of immune cells such as mast cells and basophilic leukocytes to release inflammation agents, such as cytokines, chemokines and histamine, which promote inflammation development. Also acts as potent chemoattractant for the migration of macrophages and neutrophils to the inflamed tissues, resulting in neutralization of the inflammatory triggers by multiple ways, such as phagocytosis and generation of reactive oxidants.; FUNCTION: [Acylation stimulating protein]: Adipogenic hormone that stimulates triglyceride synthesis and glucose transport in adipocytes, regulating fat storage and playing a role in postprandial triglyceride clearance. Appears to stimulate triglyceride synthesis via activation of the PLC, MAPK and AKT signaling pathways. Acts by binding to its receptor, C5AR2, activating G protein-coupled receptor signaling, promoting the phosphorylation, ARRB2-mediated internalization and endocytosis of C5AR2.; FUNCTION: [C3-beta-c]: Acts as a chemoattractant for neutrophils in chronic inflammation.
Molecular Weight
187kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBICCELISA
Clone
ARC67912
Isotype
IgG
Form
Liquid
Immunogen
Recombinant protein (or fragment).This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat