Antibodies
Anti-CA2 Antibody-Oligo Conjugate
SKU: aoc1372
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CA2 Antibody-IF1
Antibody Target
- Target
- Carbonic anhydrase 2
- UniProt Number
- P00918
- Target Description
- Catalyzes the reversible hydration of carbon dioxide (PubMed:11327835, PubMed:11802772, PubMed:11831900, PubMed:12056894, PubMed:12171926, PubMed:1336460, PubMed:14736236, PubMed:15300855, PubMed:15453828, PubMed:15667203, PubMed:15865431, PubMed:16106378, PubMed:16214338, PubMed:16290146, PubMed:16686544, PubMed:16759856, PubMed:16807956, PubMed:17127057, PubMed:17251017, PubMed:17314045, PubMed:17330962, PubMed:17346964, PubMed:17540563, PubMed:17588751, PubMed:17705204, PubMed:18024029, PubMed:18162396, PubMed:18266323, PubMed:18374572, PubMed:18481843, PubMed:18618712, PubMed:18640037, PubMed:18942852, PubMed:1909891, PubMed:1910042, PubMed:19170619, PubMed:19186056, PubMed:19206230, PubMed:19520834, PubMed:19778001, PubMed:7761440, PubMed:7901850, PubMed:8218160, PubMed:8262987, PubMed:8399159, PubMed:8451242, PubMed:8485129, PubMed:8639494, PubMed:9265618, PubMed:9398308). Can also hydrate cyanamide to urea (PubMed:10550681, PubMed:11015219). Stimulates the chloride-bicarbonate exchange activity of SLC26A6 (PubMed:15990874). Essential for bone resorption and osteoclast differentiation (PubMed:15300855). Involved in the regulation of fluid secretion into the anterior chamber of the eye. Contributes to intracellular pH regulation in the duodenal upper villous epithelium during proton-coupled peptide absorption..
- Molecular Weight
- 29kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1451
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat