Antibodies
Anti-CA2 Antibody-Oligo Conjugate
SKU: aoc1372
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CA2 Antibody-IF1
Antibody Target
- Target
- Carbonic anhydrase 2
- UniProt Number
- P00918
- Target Description
- Catalyzes the reversible hydration of carbon dioxide. Can also hydrate cyanamide to urea. Stimulates the chloride-bicarbonate exchange activity of SLC26A6. Essential for bone resorption and osteoclast differentiation. Involved in the regulation of fluid secretion into the anterior chamber of the eye. Contributes to intracellular pH regulation in the duodenal upper villous epithelium during proton-coupled peptide absorption.
- Molecular Weight
- 29kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1451
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat