Antibodies
Anti-CAD Antibody-Oligo Conjugate
SKU: aoc1375
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CAD Antibody-IF1
Antibody Target
- Target
- Multifunctional protein CAD
- UniProt Number
- P27708
- Target Description
- Multifunctional protein that encodes the first 3 enzymatic activities of the de novo pyrimidine pathway: carbamoylphosphate synthetase (CPSase; EC 6.3.5.5), aspartate transcarbamylase (ATCase; EC 2.1.3.2) and dihydroorotase (DHOase; EC 3.5.2.3). The CPSase-function is accomplished in 2 steps, by a glutamine-dependent amidotransferase activity (GATase) that binds and cleaves glutamine to produce ammonia, followed by an ammonium-dependent carbamoyl phosphate synthetase, which reacts with the ammonia, hydrogencarbonate and ATP to form carbamoyl phosphate. The endogenously produced carbamoyl phosphate is sequestered and channeled to the ATCase active site. ATCase then catalyzes the formation of carbamoyl-L-aspartate from L-aspartate and carbamoyl phosphate. In the last step, DHOase catalyzes the cyclization of carbamoyl aspartate to dihydroorotate..
- Molecular Weight
- 243kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1426
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human