AntibodiesNeuroMab
Anti-CALB1/calbindin Antibody-Oligo Conjugate
SKU: aoc25
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CALB1/calbindin Antibody-IF1
Antibody Target
- Target
- CALB1/calbindin
- UniProt Number
- P05937
- Target Description
- Calbindin (aka. calbindin D28k) is a member of the calcium-binding protein superfamily that includes calmodulin and troponin C. It is predominantly expressed in certain types of neurons, particularly in dendrites and perikarya of the cerebellum and is thought to buffer entry of calcium upon stimulation of glutamate receptors (Andressen et al., 1993). Calbindin has recently been shown to play a critical role in mitochondrial dysfunction and loss of synaptic proteins in vivo in an Alzheimer’s disease mouse model (Kook et al., 2014).
- Molecular Weight
- 30 kDa
- Synonyms
- Calbindin (Calbindin D28) (D-28K) (Vitamin D-dependent calcium-binding protein, avian-type)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCAT
- Specificity
- No cross-reactivity reported
- Clone
- L109/57
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 1-261 (full-length) of human CALB1 (accession number P05937) produced recombinantly in E. Coli
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat