AntibodiesNeuroMab
Anti-Calbindin Antibody-Oligo Conjugate
SKU: aoc25
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Calbindin Antibody-IF1
Antibody Target
- Target
- Calbindin
- UniProt Number
- P05937
- Target Description
- Buffers cytosolic calcium. May stimulate a membrane Ca(2+)-ATPase and a 3',5'-cyclic nucleotide phosphodiesterase.
- Molecular Weight
- 30 kDa
- Synonyms
- Calbindin (Calbindin D28) (D-28K) (Vitamin D-dependent calcium-binding protein, avian-type)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCAT
- Specificity
- No cross-reactivity reported
- Clone
- L109/57
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 1-261 (full-length) of human CALB1 (accession number P05937) produced recombinantly in E. Coli
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat