Antibodies
Anti-Calmegin Antibody-Oligo Conjugate (ARC2214)
SKU: aoc1379
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Calmegin Antibody (ARC2214)-IF1
Antibody Target
- Target
- Calmegin
- UniProt Number
- O14967
- Target Description
- Functions during spermatogenesis as a chaperone for a range of client proteins that are important for sperm adhesion onto the egg zona pellucida and for subsequent penetration of the zona pellucida. Required for normal sperm migration from the uterus into the oviduct. Required for normal male fertility. Binds calcium ions (By similarity)..
- Molecular Weight
- 70kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC2214
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat