Antibodies
Anti-Calnexin Antibody-Oligo Conjugate (ARC75323)
SKU: aoc1382
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Calnexin Antibody (ARC75323)-IF1
Antibody Target
- Target
- Calnexin
- UniProt Number
- P27824
- Target Description
- Calcium-binding protein that interacts with newly synthesized monoglucosylated glycoproteins in the endoplasmic reticulum. It may act in assisting protein assembly and/or in the retention within the ER of unassembled protein subunits. It seems to play a major role in the quality control apparatus of the ER by the retention of incorrectly folded proteins. Associated with partial T-cell antigen receptor complexes that escape the ER of immature thymocytes, it may function as a signaling complex regulating thymocyte maturation. Additionally it may play a role in receptor-mediated endocytosis at the synapse.
- Molecular Weight
- 68kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC75323
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human