Antibodies
Anti-Calponin Antibody-Oligo Conjugate (ARC73256)
SKU: aoc1388
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Calponin Antibody (ARC73256)-IF1
Antibody Target
- Target
- Calponin-1
- UniProt Number
- P51911
- Target Description
- Thin filament-associated protein that is implicated in the regulation and modulation of smooth muscle contraction. It is capable of binding to actin, calmodulin and tropomyosin. The interaction of calponin with actin inhibits the actomyosin Mg-ATPase activity.
- Molecular Weight
- 33kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC73256
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat