Antibodies
Anti-Calreticulin Antibody-Oligo Conjugate
SKU: aoc1389
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Calreticulin Antibody-IF1
Antibody Target
- Target
- Calreticulin
- UniProt Number
- P27797
- Target Description
- Calcium-binding chaperone that promotes folding, oligomeric assembly and quality control in the endoplasmic reticulum (ER) via the calreticulin/calnexin cycle. This lectin interacts transiently with almost all of the monoglucosylated glycoproteins that are synthesized in the ER (PubMed:7876246). Interacts with the DNA-binding domain of NR3C1 and mediates its nuclear export (PubMed:11149926). Involved in maternal gene expression regulation. May participate in oocyte maturation via the regulation of calcium homeostasis (By similarity). Present in the cortical granules of non-activated oocytes, is exocytosed during the cortical reaction in response to oocyte activation and might participate in the block to polyspermy (By similarity)..
- Molecular Weight
- 47kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- AMC50033
- Isotype
- IgG1. Rabbit-derived mouse chimeric antibody
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat