Antibodies
Anti-Calreticulin Antibody-Oligo Conjugate
SKU: aoc1389
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Calreticulin Antibody-IF1
Antibody Target
- Target
- Calreticulin
- UniProt Number
- P27797
- Target Description
- Calcium-binding chaperone that promotes folding, oligomeric assembly and quality control in the endoplasmic reticulum (ER) via the calreticulin/calnexin cycle. This lectin interacts transiently with almost all of the monoglucosylated glycoproteins that are synthesized in the ER. Interacts with the DNA-binding domain of NR3C1 and mediates its nuclear export. Involved in maternal gene expression regulation. May participate in oocyte maturation via the regulation of calcium homeostasis. Present in the cortical granules of non-activated oocytes, is exocytosed during the cortical reaction in response to oocyte activation and might participate in the block to polyspermy.
- Molecular Weight
- 47kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- AMC50033
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat