Antibodies
Anti-Calretinin Antibody-Oligo Conjugate (ARC53565)
SKU: aoc1390
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Calretinin Antibody (ARC53565)-IF1
Antibody Target
- Target
- Calretinin
- UniProt Number
- P22676
- Target Description
- Calcium-binding protein involved in calcium homeostasis and signal transduction. It plays a critical role in buffering intracellular calcium levels and modulating calcium-dependent signaling pathways (PubMed:2001709). Predominantly expressed in specific neuronal populations, influences synaptic plasticity and neuronal excitability, contributing to learning and memory (By similarity). During embryonic development, it facilitates neuronal differentiation and maturation (By similarity)..
- Molecular Weight
- 32kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC53565
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat