Antibodies
Anti-CaMKII beta Antibody-Oligo Conjugate
SKU: aoc1397
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CaMKII beta Antibody-IF1
Antibody Target
- Target
- Calcium/calmodulin-dependent protein kinase type II subunit beta
- UniProt Number
- Q13554
- Target Description
- Calcium/calmodulin-dependent protein kinase that functions autonomously after Ca(2+)/calmodulin-binding and autophosphorylation, and is involved in dendritic spine and synapse formation, neuronal plasticity and regulation of sarcoplasmic reticulum Ca(2+) transport in skeletal muscle. In neurons, plays an essential structural role in the reorganization of the actin cytoskeleton during plasticity by binding and bundling actin filaments in a kinase-independent manner. This structural function is required for correct targeting of CaMK2A, which acts downstream of NMDAR to promote dendritic spine and synapse formation and maintain synaptic plasticity which enables long-term potentiation (LTP) and hippocampus-dependent learning. In developing hippocampal neurons, promotes arborization of the dendritic tree and in mature neurons, promotes dendritic remodeling. Also regulates the migration of developing neurons. Participates in the modulation of skeletal muscle function in response to exercise. In slow-twitch muscles, is involved in regulation of sarcoplasmic reticulum (SR) Ca(2+) transport and in fast-twitch muscle participates in the control of Ca(2+) release from the SR through phosphorylation of triadin, a ryanodine receptor-coupling factor, and phospholamban (PLN/PLB), an endogenous inhibitor of SERCA2A/ATP2A2. In response to interferon-gamma (IFN-gamma) stimulation, catalyzes phosphorylation of STAT1, stimulating the JAK-STAT signaling pathway. Phosphorylates reticulophagy regulator RETREG1 at 'Ser-151' under endoplasmic reticulum stress conditions which enhances RETREG1 oligomerization and its membrane scission and reticulophagy activity.
- Molecular Weight
- 73kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1814
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat