Antibodies
Anti-CaMKII delta Antibody-Oligo Conjugate
SKU: aoc1398
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CaMKII delta Antibody-IF1
Antibody Target
- Target
- Calcium/calmodulin-dependent protein kinase type II subunit delta
- UniProt Number
- Q13557
- Target Description
- Calcium/calmodulin-dependent protein kinase involved in the regulation of Ca(2+) homeostatis and excitation-contraction coupling (ECC) in heart by targeting ion channels, transporters and accessory proteins involved in Ca(2+) influx into the myocyte, Ca(2+) release from the sarcoplasmic reticulum (SR), SR Ca(2+) uptake and Na(+) and K(+) channel transport. Targets also transcription factors and signaling molecules to regulate heart function. In its activated form, is involved in the pathogenesis of dilated cardiomyopathy and heart failure. Contributes to cardiac decompensation and heart failure by regulating SR Ca(2+) release via direct phosphorylation of RYR2 Ca(2+) channel on 'Ser-2808'. In the nucleus, phosphorylates the MEF2 repressor HDAC4, promoting its nuclear export and binding to 14-3-3 protein, and expression of MEF2 and genes involved in the hypertrophic program. Is essential for left ventricular remodeling responses to myocardial infarction. In pathological myocardial remodeling acts downstream of the beta adrenergic receptor signaling cascade to regulate key proteins involved in ECC. Regulates Ca(2+) influx to myocytes by binding and phosphorylating the L-type Ca(2+) channel subunit beta-2 CACNB2. In addition to Ca(2+) channels, can target and regulate the cardiac sarcolemmal Na(+) channel Nav1.5/SCN5A and the K+ channel Kv4.3/KCND3, which contribute to arrhythmogenesis in heart failure. Phosphorylates phospholamban (PLN/PLB), an endogenous inhibitor of SERCA2A/ATP2A2, contributing to the enhancement of SR Ca(2+) uptake that may be important in frequency-dependent acceleration of relaxation (FDAR) and maintenance of contractile function during acidosis. May participate in the modulation of skeletal muscle function in response to exercise, by regulating SR Ca(2+) transport through phosphorylation of PLN/PLB and triadin, a ryanodine receptor-coupling factor. In response to interferon-gamma (IFN-gamma) stimulation, catalyzes phosphorylation of STAT1, stimulating the JAK-STAT signaling pathway.
- Molecular Weight
- 56 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1473
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse