Antibodies
Anti-CAMP Antibody-Oligo Conjugate
SKU: aoc1399
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CAMP Antibody-IF1
Antibody Target
- Target
- Cathelicidin antimicrobial peptide
- UniProt Number
- P49913
- Target Description
- Antimicrobial protein that is an integral component of the innate immune system (PubMed:14978112, PubMed:16637646, PubMed:18818205, PubMed:22879591, PubMed:9736536). Binds to bacterial lipopolysaccharides (LPS) (PubMed:16637646, PubMed:18818205). Acts via neutrophil N-formyl peptide receptors to enhance the release of CXCL2 (PubMed:22879591). Postsecretory processing generates multiple cathelicidin antimicrobial peptides with various lengths which act as a topical antimicrobial defense in sweat on skin (PubMed:14978112). The unprocessed precursor form, cathelicidin antimicrobial peptide, inhibits the growth of Gram-negative E.coli and E.aerogenes with efficiencies comparable to that of the mature peptide LL-37 (in vitro) (PubMed:9736536)..; FUNCTION: [Antibacterial peptide LL-37]: Antimicrobial peptide that is an integral component of the innate immune system (PubMed:10417311, PubMed:15778390, PubMed:16637646, PubMed:18818205, PubMed:22879591, PubMed:32753597, PubMed:33060695, PubMed:34708076, PubMed:8681941, PubMed:9736536). Binds to bacterial lipopolysaccharides (LPS) (PubMed:10417311, PubMed:16637646, PubMed:18818205, PubMed:33060695, PubMed:9736536). Causes membrane permeabilization by forming transmembrane pores (in vitro) (PubMed:22879591, PubMed:32753597, PubMed:33060695). Causes lysis of E.coli (PubMed:10417311). Exhibits antimicrobial activity against Gram-negative bacteria such as P.aeruginosa, S.typhimurium, E.aerogenes, E.coli and P.syringae, Gram-positive bacteria such as L.monocytogenes, S.epidermidis, S.pyogenes and S.aureus, as well as vancomycin-resistant enterococci (in vitro) (PubMed:10417311, PubMed:32753597, PubMed:8681941, PubMed:9736536). Exhibits antimicrobial activity against methicillin-resistant S.aureus, P.mirabilis, and C.albicans in low-salt media, but not in media containing 100 mM NaCl (in vitro) (PubMed:9736536). Forms chiral supramolecular assemblies with quinolone signal (PQS) molecules of P.aeruginosa, which may lead to interference of bacterial quorum signaling and perturbance of bacterial biofilm formation (PubMed:34708076). May form supramolecular fiber-like assemblies on bacterial membranes (PubMed:29133814). Induces cytokine and chemokine production as well as TNF/TNFA and CSF2/GMCSF production in normal human keratinocytes (PubMed:15778390). Exhibits hemolytic activity against red blood cells (PubMed:10417311)..; FUNCTION: [Antibacterial peptide FALL-39]: Exhibits antimicrobial activity against E.coli and B.megaterium (in vitro)..; FUNCTION: [Antibacterial peptide KR-20]: Acts synergistically with peptides KS-30 and KR-31, killing bacteria such as S.aureus, E.coli and C.albicans at lower concentrations when present together, and maintains activity at increased salt condition (PubMed:14978112). Does not have the ability to stimulate CXCL8/IL8 release from keratinocytes (PubMed:14978112)..; FUNCTION: [Antibacterial peptide LL-23]: Poorly active (MIC > 150 uM) against E.coli strain K12 (PubMed:14978112). Is able to induce the pro-inflammatory cytokine TNF/TNFA or the chemokine CCL2/MCP1 (PubMed:14978112)..; FUNCTION: [Antibacterial peptide LL-29]: Moderately antibacterial..; FUNCTION: [Antibacterial peptide KS-30]: Moderately antibacterial (PubMed:14978112). Acts synergistically with peptides KR-20 and KR-31, killing bacteria such as S.aureus, E.coli and C.albicans at lower concentrations when present together, and maintain activity at increased salt condition (PubMed:14978112). Does not have the ability to stimulate CXCL8/IL8 release from keratinocytes (PubMed:14978112)..; FUNCTION: [Antibacterial peptide RK-31]: Acts synergistically with peptides KS-30 and KR-31, killing bacteria such as S.aureus, E.coli and C.albicans at lower concentrations when present together, and maintain activity at increased salt condition (PubMed:14978112). Does not have the ability to stimulate CXCL8/IL8 release from keratinocytes (PubMed:14978112)..; FUNCTION: [Antibacterial peptide FF-33]: Inhibits the growth of E.coli and B.megaterium and exhibits hemolytic activity against human red blood cells..
- Molecular Weight
- 19kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC69535
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human