Antibodies

Anti-CAMP Antibody-Oligo Conjugate

SKU: aoc1399

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-CAMP Antibody-IF1

Antibody Target

Target
Cathelicidin antimicrobial peptide
UniProt Number
P49913
Target Description
Antimicrobial protein that is an integral component of the innate immune system. Binds to bacterial lipopolysaccharides (LPS). Acts via neutrophil N-formyl peptide receptors to enhance the release of CXCL2. Postsecretory processing generates multiple cathelicidin antimicrobial peptides with various lengths which act as a topical antimicrobial defense in sweat on skin. The unprocessed precursor form, cathelicidin antimicrobial peptide, inhibits the growth of Gram-negative E.coli and E.aerogenes with efficiencies comparable to that of the mature peptide LL-37 (in vitro).; FUNCTION: [Antibacterial peptide LL-37]: Antimicrobial peptide that is an integral component of the innate immune system. Binds to bacterial lipopolysaccharides (LPS). Causes membrane permeabilization by forming transmembrane pores (in vitro). Causes lysis of E.coli. Exhibits antimicrobial activity against Gram-negative bacteria such as P.aeruginosa, S.typhimurium, E.aerogenes, E.coli and P.syringae, Gram-positive bacteria such as L.monocytogenes, S.epidermidis, S.pyogenes and S.aureus, as well as vancomycin-resistant enterococci (in vitro). Exhibits antimicrobial activity against methicillin-resistant S.aureus, P.mirabilis, and C.albicans in low-salt media, but not in media containing 100 mM NaCl (in vitro). Forms chiral supramolecular assemblies with quinolone signal (PQS) molecules of P.aeruginosa, which may lead to interference of bacterial quorum signaling and perturbance of bacterial biofilm formation. May form supramolecular fiber-like assemblies on bacterial membranes. Induces cytokine and chemokine production as well as TNF/TNFA and CSF2/GMCSF production in normal human keratinocytes. Exhibits hemolytic activity against red blood cells.; FUNCTION: [Antibacterial peptide FALL-39]: Exhibits antimicrobial activity against E.coli and B.megaterium (in vitro).; FUNCTION: [Antibacterial peptide KR-20]: Acts synergistically with peptides KS-30 and KR-31, killing bacteria such as S.aureus, E.coli and C.albicans at lower concentrations when present together, and maintains activity at increased salt condition. Does not have the ability to stimulate CXCL8/IL8 release from keratinocytes.; FUNCTION: [Antibacterial peptide LL-23]: Poorly active (MIC > 150 uM) against E.coli strain K12. Is able to induce the pro-inflammatory cytokine TNF/TNFA or the chemokine CCL2/MCP1.; FUNCTION: [Antibacterial peptide LL-29]: Moderately antibacterial.; FUNCTION: [Antibacterial peptide KS-30]: Moderately antibacterial. Acts synergistically with peptides KR-20 and KR-31, killing bacteria such as S.aureus, E.coli and C.albicans at lower concentrations when present together, and maintain activity at increased salt condition. Does not have the ability to stimulate CXCL8/IL8 release from keratinocytes.; FUNCTION: [Antibacterial peptide RK-31]: Acts synergistically with peptides KS-30 and KR-31, killing bacteria such as S.aureus, E.coli and C.albicans at lower concentrations when present together, and maintain activity at increased salt condition. Does not have the ability to stimulate CXCL8/IL8 release from keratinocytes.; FUNCTION: [Antibacterial peptide FF-33]: Inhibits the growth of E.coli and B.megaterium and exhibits hemolytic activity against human red blood cells.
Molecular Weight
19kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCELISA
Clone
ARC69535
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
Human