Antibodies
Anti-CARD11 Antibody-Oligo Conjugate
SKU: aoc1402
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CARD11 Antibody-IF1
Antibody Target
- Target
- Caspase recruitment domain-containing protein 11
- UniProt Number
- Q9BXL7
- Target Description
- Adapter protein that plays a key role in adaptive immune response by transducing the activation of NF-kappa-B downstream of T-cell receptor (TCR) and B-cell receptor (BCR) engagement. Transduces signals downstream TCR or BCR activation via the formation of a multiprotein complex together with BCL10 and MALT1 that induces NF-kappa-B and MAP kinase p38 (MAPK11, MAPK12, MAPK13 and/or MAPK14) pathways. Upon activation in response to TCR or BCR triggering, CARD11 homooligomerizes to form a nucleating helical template that recruits BCL10 via CARD-CARD interaction, thereby promoting polymerization of BCL10 and subsequent recruitment of MALT1: this leads to I-kappa-B kinase (IKK) phosphorylation and degradation, and release of NF-kappa-B proteins for nuclear translocation. Its binding to DPP4 induces T-cell proliferation and NF-kappa-B activation in a T-cell receptor/CD3-dependent manner. Promotes linear ubiquitination of BCL10 by promoting the targeting of BCL10 to RNF31/HOIP. Stimulates the phosphorylation of BCL10. Also activates the TORC1 signaling pathway.
- Molecular Weight
- 133kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC1680
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat