Antibodies
Anti-CARM1 Antibody-Oligo Conjugate
SKU: aoc1405
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-CARM1 Antibody-PLA1
Antibody Target
- Target
- Histone-arginine methyltransferase CARM1
- UniProt Number
- Q86X55
- Target Description
- Methylates (mono- and asymmetric dimethylation) the guanidino nitrogens of arginyl residues in several proteins involved in DNA packaging, transcription regulation, pre-mRNA splicing, and mRNA stability (PubMed:12237300, PubMed:16497732, PubMed:19405910). Recruited to promoters upon gene activation together with histone acetyltransferases from EP300/P300 and p160 families, methylates histone H3 at 'Arg-17' (H3R17me), forming mainly asymmetric dimethylarginine (H3R17me2a), leading to activation of transcription via chromatin remodeling (PubMed:12237300, PubMed:16497732, PubMed:19405910). During nuclear hormone receptor activation and TCF7L2/TCF4 activation, acts synergically with EP300/P300 and either one of the p160 histone acetyltransferases NCOA1/SRC1, NCOA2/GRIP1 and NCOA3/ACTR or CTNNB1/beta-catenin to activate transcription (By similarity). During myogenic transcriptional activation, acts together with NCOA3/ACTR as a coactivator for MEF2C (By similarity). During monocyte inflammatory stimulation, acts together with EP300/P300 as a coactivator for NF-kappa-B (By similarity). Acts as a coactivator for PPARG, promotes adipocyte differentiation and the accumulation of brown fat tissue (By similarity). Plays a role in the regulation of pre-mRNA alternative splicing by methylation of splicing factors (By similarity). Also seems to be involved in p53/TP53 transcriptional activation (By similarity). Methylates EP300/P300, both at 'Arg-2142', which may loosen its interaction with NCOA2/GRIP1, and at 'Arg-580' and 'Arg-604' in the KIX domain, which impairs its interaction with CREB and inhibits CREB-dependent transcriptional activation (PubMed:15731352). Also methylates arginine residues in RNA-binding proteins PABPC1, ELAVL1 and ELAV4, which may affect their mRNA-stabilizing properties and the half-life of their target mRNAs (By similarity). Acts as a transcriptional coactivator of ACACA/acetyl-CoA carboxylase by enriching H3R17 methylation at its promoter, thereby positively regulating fatty acid synthesis (By similarity). Independently of its methyltransferase activity, involved in replication fork progression: promotes PARP1 recruitment to replication forks, leading to poly-ADP-ribosylation of chromatin at replication forks and reduced fork speed (PubMed:33412112)..
- Molecular Weight
- 66kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC52397
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat