Antibodies
Anti-Casein Kinase 1 alpha (CSNK1A1) Antibody-Oligo Conjugate
SKU: aoc1409
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Casein Kinase 1 alpha (CSNK1A1) Antibody-IF1
Antibody Target
- Target
- Casein kinase I isoform alpha
- UniProt Number
- P48729
- Target Description
- Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. It can phosphorylate a large number of proteins. Participates in Wnt signaling. Phosphorylates CTNNB1 at 'Ser-45'. May phosphorylate PER1 and PER2. May play a role in segregating chromosomes during mitosis. May play a role in keratin cytoskeleton disassembly and thereby, it may regulate epithelial cell migration. Acts as a positive regulator of mTORC1 and mTORC2 signaling in response to nutrients by mediating phosphorylation of DEPTOR inhibitor. Acts as an inhibitor of NLRP3 inflammasome assembly by mediating phosphorylation of NLRP3.
- Molecular Weight
- 39kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1860
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat