Antibodies
Anti-Casein Kinase 1 alpha (CSNK1A1) Antibody-Oligo Conjugate
SKU: aoc1409
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Casein Kinase 1 alpha (CSNK1A1) Antibody-IF1
Antibody Target
- Target
- Casein kinase I isoform alpha
- UniProt Number
- P48729
- Target Description
- Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates (PubMed:11955436, PubMed:1409656, PubMed:18305108, PubMed:23902688). It can phosphorylate a large number of proteins (PubMed:11955436, PubMed:1409656, PubMed:18305108, PubMed:23902688). Participates in Wnt signaling (PubMed:11955436). Phosphorylates CTNNB1 at 'Ser-45' (PubMed:11955436). May phosphorylate PER1 and PER2 (By similarity). May play a role in segregating chromosomes during mitosis (PubMed:1409656). May play a role in keratin cytoskeleton disassembly and thereby, it may regulate epithelial cell migration (PubMed:23902688). Acts as a positive regulator of mTORC1 and mTORC2 signaling in response to nutrients by mediating phosphorylation of DEPTOR inhibitor (PubMed:22017875, PubMed:22017877). Acts as an inhibitor of NLRP3 inflammasome assembly by mediating phosphorylation of NLRP3 (By similarity)..
- Molecular Weight
- 39kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1860
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat