Antibodies
Anti-Casein Kinase 2 beta Antibody-Oligo Conjugate
SKU: aoc1410
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Casein Kinase 2 beta Antibody-IF1
Antibody Target
- Target
- Casein kinase II subunit beta
- UniProt Number
- P67870
- Target Description
- Regulatory subunit of casein kinase II/CK2. As part of the kinase complex regulates the basal catalytic activity of the alpha subunit a constitutively active serine/threonine-protein kinase that phosphorylates a large number of substrates containing acidic residues C-terminal to the phosphorylated serine or threonine. Participates in Wnt signaling.; FUNCTION: (Microbial infection) Upon infection with Epstein-Barr virus (EBV), the interaction with viral EBNA1 increases the association of CK2 with PML proteins, which increases PML phosphorylation by CK2, triggering the polyubiquitylation and degradation of PML. Seems to also suppress EBV reactivation by mediating ARK2N and JUN at the Z promoter which inhibits BZLF1 transcrition.
- Molecular Weight
- 25kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1069
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat