Antibodies
Anti-Casein Kinase 2 beta Antibody-Oligo Conjugate
SKU: aoc1410
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Casein Kinase 2 beta Antibody-IF1
Antibody Target
- Target
- Casein kinase II subunit beta
- UniProt Number
- P67870
- Target Description
- Regulatory subunit of casein kinase II/CK2. As part of the kinase complex regulates the basal catalytic activity of the alpha subunit a constitutively active serine/threonine-protein kinase that phosphorylates a large number of substrates containing acidic residues C-terminal to the phosphorylated serine or threonine (PubMed:11239457, PubMed:16818610). Participates in Wnt signaling (By similarity)..; FUNCTION: (Microbial infection) Upon infection with Epstein-Barr virus (EBV), the interaction with viral EBNA1 increases the association of CK2 with PML proteins, which increases PML phosphorylation by CK2, triggering the polyubiquitylation and degradation of PML (PubMed:20719947, PubMed:24216761). Seems to also suppress EBV reactivation by mediating ARK2N and JUN at the Z promoter which inhibits BZLF1 transcrition (PubMed:31341047)..
- Molecular Weight
- 25kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1069
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat