Antibodies
Anti-Caspase-3 Antibody-Oligo Conjugate (ARC0143)
SKU: aoc1417
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Caspase-3 Antibody (ARC0143)-IF1
Antibody Target
- Target
- Caspase-3
- UniProt Number
- P42574
- Target Description
- Thiol protease that acts as a major effector caspase involved in the execution phase of apoptosis (PubMed:18723680, PubMed:20566630, PubMed:23650375, PubMed:35338844, PubMed:35446120, PubMed:7596430). Following cleavage and activation by initiator caspases (CASP8, CASP9 and/or CASP10), mediates execution of apoptosis by catalyzing cleavage of many proteins (PubMed:18723680, PubMed:20566630, PubMed:23650375, PubMed:7596430). At the onset of apoptosis, it proteolytically cleaves poly(ADP-ribose) polymerase PARP1 at a '216-Asp-|-Gly-217' bond (PubMed:10497198, PubMed:16374543, PubMed:7596430, PubMed:7774019). Cleaves and activates sterol regulatory element binding proteins (SREBPs) between the basic helix-loop-helix leucine zipper domain and the membrane attachment domain (By similarity). Cleaves and activates caspase-6, -7 and -9 (CASP6, CASP7 and CASP9, respectively) (PubMed:7596430). Cleaves and inactivates interleukin-18 (IL18) (PubMed:37993714, PubMed:9334240). Involved in the cleavage of huntingtin (PubMed:8696339). Triggers cell adhesion in sympathetic neurons through RET cleavage (PubMed:21357690). Cleaves and inhibits serine/threonine-protein kinase AKT1 in response to oxidative stress (PubMed:23152800). Acts as an inhibitor of type I interferon production during virus-induced apoptosis by mediating cleavage of antiviral proteins CGAS, IRF3 and MAVS, thereby preventing cytokine overproduction (PubMed:30878284). Also involved in pyroptosis by mediating cleavage and activation of gasdermin-E (GSDME) (PubMed:35338844, PubMed:35446120). Cleaves XRCC4 and phospholipid scramblase proteins XKR4, XKR8 and XKR9, leading to promote phosphatidylserine exposure on apoptotic cell surface (PubMed:23845944, PubMed:33725486). Cleaves BIRC6 following inhibition of BIRC6-caspase binding by DIABLO/SMAC (PubMed:36758104, PubMed:36758106)..
- Molecular Weight
- 32kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0143
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat