Antibodies
Anti-Caspase-3 Antibody-Oligo Conjugate (ARC0143)
SKU: aoc1417
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Caspase-3 Antibody (ARC0143)-IF1
Antibody Target
- Target
- Caspase-3
- UniProt Number
- P42574
- Target Description
- Thiol protease that acts as a major effector caspase involved in the execution phase of apoptosis. Following cleavage and activation by initiator caspases (CASP8, CASP9 and/or CASP10), mediates execution of apoptosis by catalyzing cleavage of many proteins. At the onset of apoptosis, it proteolytically cleaves poly(ADP-ribose) polymerase PARP1 at a '216-Asp-|-Gly-217' bond. Cleaves and activates sterol regulatory element binding proteins (SREBPs) between the basic helix-loop-helix leucine zipper domain and the membrane attachment domain. Cleaves and activates caspase-6, -7 and -9 (CASP6, CASP7 and CASP9, respectively). Cleaves and inactivates interleukin-18 (IL18). Involved in the cleavage of huntingtin. Triggers cell adhesion in sympathetic neurons through RET cleavage. Cleaves and inhibits serine/threonine-protein kinase AKT1 in response to oxidative stress. Acts as an inhibitor of type I interferon production during virus-induced apoptosis by mediating cleavage of antiviral proteins CGAS, IRF3 and MAVS, thereby preventing cytokine overproduction. Also involved in pyroptosis by mediating cleavage and activation of gasdermin-E (GSDME). Cleaves XRCC4 and phospholipid scramblase proteins XKR4, XKR8 and XKR9, leading to promote phosphatidylserine exposure on apoptotic cell surface. Cleaves BIRC6 following inhibition of BIRC6-caspase binding by DIABLO/SMAC.
- Molecular Weight
- 32kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0143
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat