AntibodiesNeuroMab
Anti-CASPR Antibody-Oligo Conjugate
SKU: aoc8
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CASPR Antibody-IF1
Antibody Target
- Target
- CASPR
- UniProt Number
- P78357
- Target Description
- CASPR (Neurexin IV) is part of the neurexin family, which includes presynaptic proteins located in the presynaptic membrane of the brain.
- Molecular Weight
- 220 kDa
- Synonyms
- Contactin-associated protein 1 (Caspr) (Caspr1) (Neurexin IV) (Neurexin-4) (Paranodin) (p190)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIP
- Specificity
- No cross-reactivity reported
- Clone
- K65/35
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein 1308-1381 (cytoplasmic domain) of rat Caspr (accession number P97846) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- GerbilHumanMouseRat