Antibodies
Anti-CaSR Antibody-Oligo Conjugate
SKU: aoc1427
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CaSR Antibody-IF1
Antibody Target
- Target
- Extracellular calcium-sensing receptor
- UniProt Number
- P41180
- Target Description
- G-protein-coupled receptor that senses changes in the extracellular concentration of calcium ions and plays a key role in maintaining calcium homeostasis. Senses fluctuations in the circulating calcium concentration: activated by elevated circulating calcium, leading to decreased parathyroid hormone (PTH) secretion in parathyroid glands. In kidneys, acts as a key regulator of renal tubular calcium resorption. Ligand binding causes a conformation change that triggers signaling via guanine nucleotide-binding proteins (G-proteins) and modulates the activity of downstream effectors. CASR is coupled with different G(q)/G(11), G(i)/G(o)- or G(s)-classes of G-proteins depending on the context. In the parathyroid and kidney, CASR signals through G(q)/G(11) and G(i)/G(o) G-proteins: G(q)/G(11) coupling activates phospholipase C-beta, releasing diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3) second messengers, while G(i)/G(o) coupling mediates inhibition of adenylate cyclase activity. The G-protein-coupled receptor activity is activated by a co-agonist mechanism: aromatic amino acids, such as Trp or Phe, act concertedly with divalent cations, such as calcium or magnesium, to achieve full receptor activation. Acts as an activator of the NLRP3 inflammasome via G(i)/G(o)-mediated signaling: down-regulation of cyclic AMP (cAMP) relieving NLRP3 inhibition by cAMP. Acts as a regulator of proton-sensing receptor GPR68 in a seesaw manner: CASR-mediated signaling inhibits GPR68 signaling in response to extracellular calcium, while GPR68 inhibits CASR in presence of extracellular protons.
- Molecular Weight
- 121kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC69622
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat