Antibodies
Anti-CaSR Antibody-Oligo Conjugate
SKU: aoc1427
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CaSR Antibody-IF1
Antibody Target
- Target
- Extracellular calcium-sensing receptor
- UniProt Number
- P41180
- Target Description
- G-protein-coupled receptor that senses changes in the extracellular concentration of calcium ions and plays a key role in maintaining calcium homeostasis (PubMed:17555508, PubMed:19789209, PubMed:21566075, PubMed:22114145, PubMed:22789683, PubMed:23966241, PubMed:25104082, PubMed:25292184, PubMed:25766501, PubMed:26386835, PubMed:32817431, PubMed:33603117, PubMed:34194040, PubMed:34467854, PubMed:7759551, PubMed:8636323, PubMed:8702647, PubMed:8878438). Senses fluctuations in the circulating calcium concentration: activated by elevated circulating calcium, leading to decreased parathyroid hormone (PTH) secretion in parathyroid glands (By similarity). In kidneys, acts as a key regulator of renal tubular calcium resorption (By similarity). Ligand binding causes a conformation change that triggers signaling via guanine nucleotide-binding proteins (G-proteins) and modulates the activity of downstream effectors (PubMed:38632411). CASR is coupled with different G(q)/G(11), G(i)/G(o)- or G(s)-classes of G-proteins depending on the context (PubMed:38632411). In the parathyroid and kidney, CASR signals through G(q)/G(11) and G(i)/G(o) G-proteins: G(q)/G(11) coupling activates phospholipase C-beta, releasing diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3) second messengers, while G(i)/G(o) coupling mediates inhibition of adenylate cyclase activity (PubMed:38632411, PubMed:7759551). The G-protein-coupled receptor activity is activated by a co-agonist mechanism: aromatic amino acids, such as Trp or Phe, act concertedly with divalent cations, such as calcium or magnesium, to achieve full receptor activation (PubMed:27386547, PubMed:27434672, PubMed:32817431, PubMed:33603117, PubMed:34194040). Acts as an activator of the NLRP3 inflammasome via G(i)/G(o)-mediated signaling: down-regulation of cyclic AMP (cAMP) relieving NLRP3 inhibition by cAMP (PubMed:32843625). Acts as a regulator of proton-sensing receptor GPR68 in a seesaw manner: CASR-mediated signaling inhibits GPR68 signaling in response to extracellular calcium, while GPR68 inhibits CASR in presence of extracellular protons (By similarity)..
- Molecular Weight
- 121kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC69622
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat