Antibodies
Anti-δ-Catenin/p120 Catenin Antibody-Oligo Conjugate
SKU: aoc3849
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-δ-Catenin/p120 Catenin Antibody-IF1
Antibody Target
- Target
- Catenin delta-1
- UniProt Number
- O60716
- Target Description
- Key regulator of cell-cell adhesion that associates with and regulates the cell adhesion properties of both C-, E- and N-cadherins, being critical for their surface stability. Promotes localization and retention of DSG3 at cell-cell junctions, via its interaction with DSG3. Beside cell-cell adhesion, regulates gene transcription through several transcription factors including ZBTB33/Kaiso2 and GLIS2, and the activity of Rho family GTPases and downstream cytoskeletal dynamics. Implicated both in cell transformation by SRC and in ligand-induced receptor signaling through the EGF, PDGF, CSF-1 and ERBB2 receptors.
- Molecular Weight
- 108kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC0586
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat