Antibodies
Anti-Cathepsin B Antibody-Oligo Conjugate (ARC0395)
SKU: aoc1429
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Cathepsin B Antibody (ARC0395)-IF1
Antibody Target
- Target
- Cathepsin B
- UniProt Number
- P07858
- Target Description
- Thiol protease which is believed to participate in intracellular degradation and turnover of proteins (PubMed:12220505). Cleaves matrix extracellular phosphoglycoprotein MEPE (PubMed:12220505). Involved in the solubilization of cross-linked TG/thyroglobulin in the thyroid follicle lumen (By similarity). Has also been implicated in tumor invasion and metastasis (PubMed:3972105)..
- Molecular Weight
- 38kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0395
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human