Antibodies
Anti-Cathepsin L Antibody-Oligo Conjugate
SKU: aoc1435
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Cathepsin L Antibody-IF1
Antibody Target
- Target
- Procathepsin L
- UniProt Number
- P07711
- Target Description
- Thiol protease important for the overall degradation of proteins in lysosomes (Probable). Plays a critical for normal cellular functions such as general protein turnover, antigen processing and bone remodeling. Involved in the solubilization of cross-linked TG/thyroglobulin and in the subsequent release of thyroid hormone thyroxine (T4) by limited proteolysis of TG/thyroglobulin in the thyroid follicle lumen (By similarity). In neuroendocrine chromaffin cells secretory vesicles, catalyzes the prohormone proenkephalin processing to the active enkephalin peptide neurotransmitter (By similarity). In thymus, regulates CD4(+) T cell positive selection by generating the major histocompatibility complex class II (MHCII) bound peptide ligands presented by cortical thymic epithelial cells. Also mediates invariant chain processing in cortical thymic epithelial cells (By similarity). Major elastin-degrading enzyme at neutral pH. Accumulates as a mature and active enzyme in the extracellular space of antigen presenting cells (APCs) to regulate degradation of the extracellular matrix in the course of inflammation (By similarity). Secreted form generates endostatin from COL18A1 (PubMed:10716919). Critical for cardiac morphology and function. Plays an important role in hair follicle morphogenesis and cycling, as well as epidermal differentiation (By similarity). Required for maximal stimulation of steroidogenesis by TIMP1 (By similarity)..; FUNCTION: (Microbial infection) In cells lacking TMPRSS2 expression, facilitates human coronaviruses SARS-CoV and SARS-CoV-2 infections via a slow acid-activated route with the proteolysis of coronavirus spike (S) glycoproteins in lysosome for entry into host cell (PubMed:16339146, PubMed:18562523, PubMed:32142651, PubMed:32221306, PubMed:37990007). Proteolysis within lysosomes is sufficient to activate membrane fusion by coronaviruses SARS-CoV and EMC (HCoV-EMC) S as well as Zaire ebolavirus glycoproteins (PubMed:16081529, PubMed:18562523, PubMed:26953343)..; FUNCTION: [Isoform 2]: Functions in the regulation of cell cycle progression through proteolytic processing of the CUX1 transcription factor (PubMed:15099520). Translation initiation at downstream start sites allows the synthesis of isoforms that are devoid of a signal peptide and localize to the nucleus where they cleave the CUX1 transcription factor and modify its DNA binding properties (PubMed:15099520)..
- Molecular Weight
- 38kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC59023
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human