Antibodies
Anti-Caveolin-1 Antibody-Oligo Conjugate (AMC50102)
SKU: aoc1438
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Caveolin-1 Antibody (AMC50102)-IF1
Antibody Target
- Target
- Caveolin-1
- UniProt Number
- Q03135
- Target Description
- May act as a scaffolding protein within caveolar membranes. Forms a stable heterooligomeric complex with CAV2 that targets to lipid rafts and drives caveolae formation. Mediates the recruitment of CAVIN proteins (CAVIN1/2/3/4) to the caveolae. Interacts directly with G-protein alpha subunits and can functionally regulate their activity. Involved in the costimulatory signal essential for T-cell receptor (TCR)-mediated T-cell activation. Its binding to DPP4 induces T-cell proliferation and NF-kappa-B activation in a T-cell receptor/CD3-dependent manner. Recruits CTNNB1 to caveolar membranes and may regulate CTNNB1-mediated signaling through the Wnt pathway. Negatively regulates TGFB1-mediated activation of SMAD2/3 by mediating the internalization of TGFBR1 from membrane rafts leading to its subsequent degradation. Binds 20(S)-hydroxycholesterol (20(S)-OHC).
- Molecular Weight
- 17 kDa/20 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- AMC50102
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat