Antibodies
Anti-Caveolin-2 Antibody-Oligo Conjugate
SKU: aoc1440
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Caveolin-2 Antibody-IF1
Antibody Target
- Target
- Caveolin-2
- UniProt Number
- P51636
- Target Description
- May act as a scaffolding protein within caveolar membranes. Interacts directly with G-protein alpha subunits and can functionally regulate their activity. Acts as an accessory protein in conjunction with CAV1 in targeting to lipid rafts and driving caveolae formation. The Ser-36 phosphorylated form has a role in modulating mitosis in endothelial cells. Positive regulator of cellular mitogenesis of the MAPK signaling pathway. Required for the insulin-stimulated nuclear translocation and activation of MAPK1 and STAT3, and the subsequent regulation of cell cycle progression.
- Molecular Weight
- 18kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC0323
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse