Antibodies
Anti-Caveolin-3 Antibody-Oligo Conjugate
SKU: aoc1441
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Caveolin-3 Antibody-IF1
Antibody Target
- Target
- Caveolin-3
- UniProt Number
- P56539
- Target Description
- May act as a scaffolding protein within caveolar membranes. Interacts directly with G-protein alpha subunits and can functionally regulate their activity. May also regulate voltage-gated potassium channels. Plays a role in the sarcolemma repair mechanism of both skeletal muscle and cardiomyocytes that permits rapid resealing of membranes disrupted by mechanical stress (By similarity). Mediates the recruitment of CAVIN2 and CAVIN3 proteins to the caveolae (PubMed:19262564)..
- Molecular Weight
- 17kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2473
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat