Antibodies
Anti-CBL Antibody-Oligo Conjugate
SKU: aoc1442
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CBL Antibody-IF1
Antibody Target
- Target
- E3 ubiquitin-protein ligase CBL
- UniProt Number
- P22681
- Target Description
- E3 ubiquitin-protein ligase that acts as a negative regulator of many signaling pathways by mediating ubiquitination of cell surface receptors. Accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes, and then transfers it to substrates promoting their degradation by the proteasome. Recognizes activated receptor tyrosine kinases, including KIT, FLT1, FGFR1, FGFR2, PDGFRA, PDGFRB, CSF1R, EPHA8 and KDR and mediates their ubiquitination to terminate signaling. Recognizes membrane-bound HCK, SRC and other kinases of the SRC family and mediates their ubiquitination and degradation. Ubiquitinates EGFR and SPRY2. Ubiquitinates NECTIN1 following association between NECTIN1 and herpes simplex virus 1/HHV-1 envelope glycoprotein D, leading to NECTIN1 removal from cell surface. Participates in signal transduction in hematopoietic cells. Plays an important role in the regulation of osteoblast differentiation and apoptosis. Essential for osteoclastic bone resorption. The 'Tyr-731' phosphorylated form induces the activation and recruitment of phosphatidylinositol 3-kinase to the cell membrane in a signaling pathway that is critical for osteoclast function. May be functionally coupled with the E2 ubiquitin-protein ligase UB2D3. In association with CBLB, required for proper feedback inhibition of ciliary platelet-derived growth factor receptor-alpha (PDGFRA) signaling pathway via ubiquitination and internalization of PDGFRA.
- Molecular Weight
- 100kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC59894
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat