Antibodies
Anti-CBL Antibody-Oligo Conjugate
SKU: aoc1442
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CBL Antibody-IF1
Antibody Target
- Target
- E3 ubiquitin-protein ligase CBL
- UniProt Number
- P22681
- Target Description
- E3 ubiquitin-protein ligase that acts as a negative regulator of many signaling pathways by mediating ubiquitination of cell surface receptors (PubMed:10514377, PubMed:11896602, PubMed:14661060, PubMed:14739300, PubMed:15190072, PubMed:17509076, PubMed:18374639, PubMed:19689429, PubMed:21596750, PubMed:28381567). Accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes, and then transfers it to substrates promoting their degradation by the proteasome (PubMed:10514377, PubMed:14661060, PubMed:14739300, PubMed:17094949, PubMed:17509076, PubMed:17974561). Recognizes activated receptor tyrosine kinases, including KIT, FLT1, FGFR1, FGFR2, PDGFRA, PDGFRB, CSF1R, EPHA8 and KDR and mediates their ubiquitination to terminate signaling (PubMed:15190072, PubMed:18374639, PubMed:21596750). Recognizes membrane-bound HCK, SRC and other kinases of the SRC family and mediates their ubiquitination and degradation (PubMed:11896602). Ubiquitinates EGFR and SPRY2 (PubMed:17094949, PubMed:17974561). Ubiquitinates NECTIN1 following association between NECTIN1 and herpes simplex virus 1/HHV-1 envelope glycoprotein D, leading to NECTIN1 removal from cell surface (PubMed:28381567). Participates in signal transduction in hematopoietic cells. Plays an important role in the regulation of osteoblast differentiation and apoptosis (PubMed:15190072, PubMed:18374639). Essential for osteoclastic bone resorption (PubMed:14739300). The 'Tyr-731' phosphorylated form induces the activation and recruitment of phosphatidylinositol 3-kinase to the cell membrane in a signaling pathway that is critical for osteoclast function (PubMed:14739300). May be functionally coupled with the E2 ubiquitin-protein ligase UB2D3. In association with CBLB, required for proper feedback inhibition of ciliary platelet-derived growth factor receptor-alpha (PDGFRA) signaling pathway via ubiquitination and internalization of PDGFRA (By similarity)..
- Molecular Weight
- 100kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC59894
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat