Antibodies
Anti-CBR1 Antibody-Oligo Conjugate (ARC2432)
SKU: aoc1443
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CBR1 Antibody (ARC2432)-IF1
Antibody Target
- Target
- Carbonyl reductase [NADPH] 1
- UniProt Number
- P16152
- Target Description
- NADPH-dependent reductase with broad substrate specificity. Catalyzes the reduction of a wide variety of carbonyl compounds including quinones, prostaglandins, menadione, plus various xenobiotics. Catalyzes the reduction of the antitumor anthracyclines doxorubicin and daunorubicin to the cardiotoxic compounds doxorubicinol and daunorubicinol. Can convert prostaglandin E to prostaglandin F2-alpha. Can bind glutathione, which explains its higher affinity for glutathione-conjugated substrates. Catalyzes the reduction of S-nitrosoglutathione. In addition, participates in the glucocorticoid metabolism by catalyzing the NADPH-dependent cortisol/corticosterone into 20beta-dihydrocortisol (20b-DHF) or 20beta-corticosterone (20b-DHB), which are weak agonists of NR3C1 and NR3C2 in adipose tissue.
- Molecular Weight
- 30kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2432
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse