Antibodies
Anti-CBR1 Antibody-Oligo Conjugate (ARC3075)
SKU: aoc1444
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CBR1 Antibody (ARC3075)-IF1
Antibody Target
- Target
- Carbonyl reductase [NADPH] 1
- UniProt Number
- P16152
- Target Description
- NADPH-dependent reductase with broad substrate specificity. Catalyzes the reduction of a wide variety of carbonyl compounds including quinones, prostaglandins, menadione, plus various xenobiotics. Catalyzes the reduction of the antitumor anthracyclines doxorubicin and daunorubicin to the cardiotoxic compounds doxorubicinol and daunorubicinol (PubMed:15799708, PubMed:17344335, PubMed:17912391, PubMed:18449627, PubMed:18826943, PubMed:1921984, PubMed:7005231). Can convert prostaglandin E to prostaglandin F2-alpha (By similarity). Can bind glutathione, which explains its higher affinity for glutathione-conjugated substrates. Catalyzes the reduction of S-nitrosoglutathione (PubMed:17344335, PubMed:18826943). In addition, participates in the glucocorticoid metabolism by catalyzing the NADPH-dependent cortisol/corticosterone into 20beta-dihydrocortisol (20b-DHF) or 20beta-corticosterone (20b-DHB), which are weak agonists of NR3C1 and NR3C2 in adipose tissue (PubMed:28878267)..
- Molecular Weight
- 30kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC3075
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat