Antibodies
Anti-CBS Antibody-Oligo Conjugate
SKU: aoc1445
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CBS Antibody-IF1
Antibody Target
- Target
- Cystathionine beta-synthase
- UniProt Number
- P35520
- Target Description
- Hydro-lyase catalyzing the first step of the transsulfuration pathway, where the hydroxyl group of L-serine is displaced by L-homocysteine in a beta-replacement reaction to form L-cystathionine, the precursor of L-cysteine. This catabolic route allows the elimination of L-methionine and the toxic metabolite L-homocysteine (PubMed:20506325, PubMed:23974653, PubMed:23981774). Also involved in the production of hydrogen sulfide, a gasotransmitter with signaling and cytoprotective effects on neurons (By similarity)..
- Molecular Weight
- 61kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC0643
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human