Antibodies
Anti-CC2D1A Antibody-Oligo Conjugate
SKU: aoc1448
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CC2D1A Antibody-IF1
Antibody Target
- Target
- Coiled-coil and C2 domain-containing protein 1A
- UniProt Number
- Q6P1N0
- Target Description
- Transcription factor that binds specifically to the DRE (dual repressor element) and represses HTR1A gene transcription in neuronal cells. The combination of calcium and ATP specifically inactivates the binding with FRE. May play a role in the altered regulation of HTR1A associated with anxiety and major depression. Mediates HDAC-independent repression of HTR1A promoter in neuronal cell. Performs essential function in controlling functional maturation of synapses. Plays distinct roles depending on its localization. When cytoplasmic, acts as a scaffold protein in the PI3K/PDK1/AKT pathway. Repressor of HTR1A when nuclear. In the centrosome, regulates spindle pole localization of the cohesin subunit SCC1/RAD21, thereby mediating centriole cohesion during mitosis.
- Molecular Weight
- 104kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCELISA
- Clone
- ARC2464
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human