Antibodies
Anti-CCL17 Antibody-Oligo Conjugate
SKU: aoc1450
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CCL17 Antibody-IF1
Antibody Target
- Target
- C-C motif chemokine 17
- UniProt Number
- Q92583
- Target Description
- Chemokine, which displays chemotactic activity for T lymphocytes, preferentially Th2 cells, but not monocytes or granulocytes. Therefore plays an important role in a wide range of inflammatory and immunological processes. Acts by binding to CCR4 at T-cell surface. Mediates GM-CSF/CSF2-driven pain and inflammation. In the brain, required to maintain the typical, highly branched morphology of hippocampal microglia under homeostatic conditions. May be important for the appropriate adaptation of microglial morphology and synaptic plasticity to acute lipopolysaccharide (LPS)-induced neuroinflammation. Plays a role in wound healing, mainly by inducing fibroblast migration into the wound.
- Molecular Weight
- 11kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC65355
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat