Antibodies
Anti-CCT2 Antibody-Oligo Conjugate
SKU: aoc1456
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CCT2 Antibody-IF1
Antibody Target
- Target
- T-complex protein 1 subunit beta
- UniProt Number
- P78371
- Target Description
- Component of the chaperonin-containing T-complex (TRiC), a molecular chaperone complex that assists the folding of actin, tubulin and other proteins upon ATP hydrolysis (PubMed:25467444, PubMed:36493755, PubMed:35449234, PubMed:37193829). The TRiC complex mediates the folding of WRAP53/TCAB1, thereby regulating telomere maintenance (PubMed:25467444). As part of the TRiC complex may play a role in the assembly of BBSome, a complex involved in ciliogenesis regulating transports vesicles to the cilia (PubMed:20080638)..
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1097
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat