Antibodies
Anti-CD10 Antibody-Oligo Conjugate (ARC55336)
SKU: aoc1457
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD10 Antibody (ARC55336)-IF1
Antibody Target
- Target
- Neprilysin
- UniProt Number
- P08473
- Target Description
- Thermolysin-like specificity, but is almost confined on acting on polypeptides of up to 30 amino acids. Biologically important in the destruction of opioid peptides such as Met- and Leu-enkephalins by cleavage of a Gly-Phe bond. Catalyzes cleavage of bradykinin, substance P and neurotensin peptides. Able to cleave angiotensin-1, angiotensin-2 and angiotensin 1-9. Involved in the degradation of atrial natriuretic factor (ANF) and brain natriuretic factor (BNP(1-32)). Displays UV-inducible elastase activity toward skin preelastic and elastic fibers.
- Molecular Weight
- 86kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC55336
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat