Antibodies
Anti-CD100 Antibody-Oligo Conjugate (ARC2801)
SKU: aoc1460
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD100 Antibody (ARC2801)-IF1
Antibody Target
- Target
- Semaphorin-4D
- UniProt Number
- Q92854
- Target Description
- Cell surface receptor for PLXNB1 and PLXNB2 that plays an important role in cell-cell signaling (PubMed:20877282). Regulates GABAergic synapse development (By similarity). Promotes the development of inhibitory synapses in a PLXNB1-dependent manner (By similarity). Modulates the complexity and arborization of developing neurites in hippocampal neurons by activating PLXNB1 and interaction with PLXNB1 mediates activation of RHOA (PubMed:19788569). Promotes the migration of cerebellar granule cells (PubMed:16055703). Plays a role in the immune system; induces B-cells to aggregate and improves their viability (in vitro) (PubMed:8876214). Induces endothelial cell migration through the activation of PTK2B/PYK2, SRC, and the phosphatidylinositol 3-kinase-AKT pathway (PubMed:16055703)..
- Molecular Weight
- 96kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2801
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human