Antibodies
Anti-CD100 Antibody-Oligo Conjugate (ARC63157)
SKU: aoc1461
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD100 Antibody (ARC63157)-IF1
Antibody Target
- Target
- Semaphorin-4D
- UniProt Number
- Q92854
- Target Description
- Cell surface receptor for PLXNB1 and PLXNB2 that plays an important role in cell-cell signaling. Regulates GABAergic synapse development. Promotes the development of inhibitory synapses in a PLXNB1-dependent manner. Modulates the complexity and arborization of developing neurites in hippocampal neurons by activating PLXNB1 and interaction with PLXNB1 mediates activation of RHOA. Promotes the migration of cerebellar granule cells. Plays a role in the immune system; induces B-cells to aggregate and improves their viability (in vitro). Induces endothelial cell migration through the activation of PTK2B/PYK2, SRC, and the phosphatidylinositol 3-kinase-AKT pathway.
- Molecular Weight
- 82kDa/96kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- ICCFlow CytometryELISA
- Clone
- ARC63157
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human