Antibodies
Anti-CD105 Antibody-Oligo Conjugate (ARC0446)
SKU: aoc1464
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD105 Antibody (ARC0446)-IF1
Antibody Target
- Target
- Endoglin
- UniProt Number
- P17813
- Target Description
- Vascular endothelium glycoprotein that plays an important role in the regulation of angiogenesis. Required for normal structure and integrity of adult vasculature. Regulates the migration of vascular endothelial cells. Required for normal extraembryonic angiogenesis and for embryonic heart development. May regulate endothelial cell shape changes in response to blood flow, which drive vascular remodeling and establishment of normal vascular morphology during angiogenesis. May play a critical role in the binding of endothelial cells to integrins and/or other RGD receptors. Acts as a TGF-beta coreceptor and is involved in the TGF-beta/BMP signaling cascade that ultimately leads to the activation of SMAD transcription factors. Required for GDF2/BMP9 signaling through SMAD1 in endothelial cells and modulates TGFB1 signaling through SMAD3.
- Molecular Weight
- 71kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0446
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human