Antibodies
Anti-CD117 | c-kit Antibody-Oligo Conjugate
SKU: aoc1469
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD117 | c-kit Antibody-IF1
Antibody Target
- Target
- Mast/stem cell growth factor receptor Kit
- UniProt Number
- P10721
- Target Description
- Tyrosine-protein kinase that acts as a cell-surface receptor for the cytokine KITLG/SCF and plays an essential role in the regulation of cell survival and proliferation, hematopoiesis, stem cell maintenance, gametogenesis, mast cell development, migration and function, and in melanogenesis. In response to KITLG/SCF binding, KIT can activate several signaling pathways. Phosphorylates PIK3R1, PLCG1, SH2B2/APS and CBL. Activates the AKT1 signaling pathway by phosphorylation of PIK3R1, the regulatory subunit of phosphatidylinositol 3-kinase. Activated KIT also transmits signals via GRB2 and activation of RAS, RAF1 and the MAP kinases MAPK1/ERK2 and/or MAPK3/ERK1. Promotes activation of STAT family members STAT1, STAT3, STAT5A and STAT5B. Activation of PLCG1 leads to the production of the cellular signaling molecules diacylglycerol and inositol 1,4,5-trisphosphate. KIT signaling is modulated by protein phosphatases, and by rapid internalization and degradation of the receptor. Activated KIT promotes phosphorylation of the protein phosphatases PTPN6/SHP-1 and PTPRU, and of the transcription factors STAT1, STAT3, STAT5A and STAT5B. Promotes phosphorylation of PIK3R1, CBL, CRK (isoform Crk-II), LYN, MAPK1/ERK2 and/or MAPK3/ERK1, PLCG1, SRC and SHC1.
- Molecular Weight
- 110kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC75149
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human