Antibodies
Anti-CD11a Antibody-Oligo Conjugate
SKU: aoc1471
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD11a Antibody-IF1
Antibody Target
- Target
- Integrin alpha-L
- UniProt Number
- P20701
- Target Description
- Integrin ITGAL/ITGB2 is a receptor for ICAM1, ICAM2, ICAM3 and ICAM4. Integrin ITGAL/ITGB2 is a receptor for F11R (PubMed:11812992, PubMed:15528364). Integrin ITGAL/ITGB2 is a receptor for the secreted form of ubiquitin-like protein ISG15; the interaction is mediated by ITGAL (PubMed:29100055). Involved in a variety of immune phenomena including leukocyte-endothelial cell interaction, cytotoxic T-cell mediated killing, and antibody dependent killing by granulocytes and monocytes. Contributes to natural killer cell cytotoxicity (PubMed:15356110). Involved in leukocyte adhesion and transmigration of leukocytes including T-cells and neutrophils (PubMed:11812992). Acts as a platform at the immunological synapse to translate TCR engagement and density of the ITGAL ligand ICAM1 into graded adhesion (PubMed:38195629). Required for generation of common lymphoid progenitor cells in bone marrow, indicating a role in lymphopoiesis (By similarity). Integrin ITGAL/ITGB2 in association with ICAM3, contributes to apoptotic neutrophil phagocytosis by macrophages (PubMed:23775590)..
- Molecular Weight
- 119kDa/128kDa/134kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC62726
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat