Antibodies
Anti-CD11a Antibody-Oligo Conjugate
SKU: aoc1471
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD11a Antibody-IF1
Antibody Target
- Target
- Integrin alpha-L
- UniProt Number
- P20701
- Target Description
- Integrin ITGAL/ITGB2 is a receptor for ICAM1, ICAM2, ICAM3 and ICAM4. Integrin ITGAL/ITGB2 is a receptor for F11R. Integrin ITGAL/ITGB2 is a receptor for the secreted form of ubiquitin-like protein ISG15; the interaction is mediated by ITGAL. Involved in a variety of immune phenomena including leukocyte-endothelial cell interaction, cytotoxic T-cell mediated killing, and antibody dependent killing by granulocytes and monocytes. Contributes to natural killer cell cytotoxicity. Involved in leukocyte adhesion and transmigration of leukocytes including T-cells and neutrophils. Acts as a platform at the immunological synapse to translate TCR engagement and density of the ITGAL ligand ICAM1 into graded adhesion. Required for generation of common lymphoid progenitor cells in bone marrow, indicating a role in lymphopoiesis. Integrin ITGAL/ITGB2 in association with ICAM3, contributes to apoptotic neutrophil phagocytosis by macrophages.
- Molecular Weight
- 119kDa/128kDa/134kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC62726
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat