Antibodies
Anti-CD11b Antibody-Oligo Conjugate
SKU: aoc1473
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD11b Antibody-IF1
Antibody Target
- Target
- Integrin alpha-M
- UniProt Number
- P11215
- Target Description
- Integrin ITGAM/ITGB2 is implicated in various adhesive interactions of monocytes, macrophages and granulocytes as well as in mediating the uptake of complement-coated particles and pathogens (PubMed:20008295, PubMed:9558116). It is identical with CR-3, the receptor for the iC3b fragment of the third complement component. It probably recognizes the R-G-D peptide in C3b. Integrin ITGAM/ITGB2 is also a receptor for fibrinogen, factor X and ICAM1. It recognizes P1 and P2 peptides of fibrinogen gamma chain. Regulates neutrophil migration (PubMed:28807980). In association with beta subunit ITGB2/CD18, required for CD177-PRTN3-mediated activation of TNF primed neutrophils (PubMed:21193407). May regulate phagocytosis-induced apoptosis in extravasated neutrophils (By similarity). May play a role in mast cell development (By similarity). Required with TYROBP/DAP12 in microglia to control production of microglial superoxide ions which promote the neuronal apoptosis that occurs during brain development (By similarity)..
- Molecular Weight
- 127kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC69343
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human