Antibodies
Anti-CD13 Antibody-Oligo Conjugate
SKU: aoc1476
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD13 Antibody-IF1
Antibody Target
- Target
- Aminopeptidase N
- UniProt Number
- P15144
- Target Description
- Broad specificity aminopeptidase which plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Also involved in the processing of various peptides including peptide hormones, such as angiotensin III and IV, neuropeptides, and chemokines. May also be involved the cleavage of peptides bound to major histocompatibility complex class II molecules of antigen presenting cells. May have a role in angiogenesis and promote cholesterol crystallization. May have a role in amino acid transport by acting as binding partner of amino acid transporter SLC6A19 and regulating its activity (By similarity)..; FUNCTION: (Microbial infection) Acts as a receptor for human coronavirus 229E/HCoV-229E. In case of human coronavirus 229E (HCoV-229E) infection, serves as receptor for HCoV-229E spike glycoprotein..; FUNCTION: (Microbial infection) Mediates as well Human cytomegalovirus (HCMV) infection..
- Molecular Weight
- 110kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC0670
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat