Antibodies
Anti-CD14 Antibody-Oligo Conjugate
SKU: aoc1480
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD14 Antibody-IF1
Antibody Target
- Target
- Monocyte differentiation antigen CD14
- UniProt Number
- P08571
- Target Description
- Coreceptor for bacterial lipopolysaccharide. In concert with LBP, binds to monomeric lipopolysaccharide and delivers it to the LY96/TLR4 complex, thereby mediating the innate immune response to bacterial lipopolysaccharide (LPS). Acts via MyD88, TIRAP and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. Acts as a coreceptor for TLR2:TLR6 heterodimer in response to diacylated lipopeptides and for TLR2:TLR1 heterodimer in response to triacylated lipopeptides, these clusters trigger signaling from the cell surface and subsequently are targeted to the Golgi in a lipid-raft dependent pathway. Binds electronegative LDL (LDL(-)) and mediates the cytokine release induced by LDL(-).
- Molecular Weight
- 40kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- ICCIF-PIHCELISA
- Clone
- ARC0353
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human