Antibodies
Anti-CD146 Antibody-Oligo Conjugate (ARC53805)
SKU: aoc1482
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD146 Antibody (ARC53805)-IF1
Antibody Target
- Target
- Cell surface glycoprotein MUC18
- UniProt Number
- P43121
- Target Description
- Plays a role in cell adhesion, and in cohesion of the endothelial monolayer at intercellular junctions in vascular tissue. Its expression may allow melanoma cells to interact with cellular elements of the vascular system, thereby enhancing hematogeneous tumor spread. Could be an adhesion molecule active in neural crest cells during embryonic development. Acts as a surface receptor that triggers tyrosine phosphorylation of FYN and PTK2/FAK1, and a transient increase in the intracellular calcium concentration.
- Molecular Weight
- 72kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC53805
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human