Antibodies
Anti-CD147 Antibody-Oligo Conjugate (ARC2742)
SKU: aoc1486
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD147 Antibody (ARC2742)-IF1
Antibody Target
- Target
- Basigin
- UniProt Number
- P35613
- Target Description
- [Isoform 1]: Essential for normal retinal maturation and development (By similarity). Acts as a retinal cell surface receptor for NXNL1 and plays an important role in NXNL1-mediated survival of retinal cone photoreceptors (PubMed:25957687). In association with glucose transporter SLC16A1/GLUT1 and NXNL1, promotes retinal cone survival by enhancing aerobic glycolysis and accelerating the entry of glucose into photoreceptors (PubMed:25957687). May act as a potent stimulator of IL6 secretion in multiple cell lines that include monocytes (PubMed:21620857)..; FUNCTION: [Isoform 1]: (Microbial infection) Erythrocyte receptor for P.falciparum RH5 which is essential for erythrocyte invasion by the merozoite stage of P.falciparum isolates 3D7 and Dd2..; FUNCTION: [Isoform 2]: Signaling receptor for cyclophilins, essential for PPIA/CYPA and PPIB/CYPB-dependent signaling related to chemotaxis and adhesion of immune cells (PubMed:11688976, PubMed:11943775). Plays an important role in targeting monocarboxylate transporters SLC16A1/GLUT1, SLC16A11 and SLC16A12 to the plasma membrane (PubMed:17127621, PubMed:21778275, PubMed:28666119). Acts as a coreceptor for vascular endothelial growth factor receptor 2 (KDR/VEGFR2) in endothelial cells enhancing its VEGFA-mediated activation and downstream signaling (PubMed:25825981). Promotes angiogenesis through EPAS1/HIF2A-mediated up-regulation of VEGFA (isoform VEGF-165 and VEGF-121) and KDR/VEGFR2 in endothelial cells (PubMed:19837976). Plays a key role in regulating tumor growth, invasion, metastasis and neoangiogenesis by stimulating the production and release of extracellular matrix metalloproteinases and KDR/VEGFR2 by both tumor cells and stromal cells (fibroblasts and endothelial cells) (PubMed:11992541, PubMed:12553375, PubMed:15833850)..; FUNCTION: [Isoform 2]: (Microbial infection) Erythrocyte receptor for P.falciparum RH5 which is essential for erythrocyte invasion by the merozoite stage of P.falciparum isolates 3D7, Dd2, 7G8 and HB3 (PubMed:22080952, PubMed:26195724). Binding of P.falciparum RH5 results in BSG dimerization which triggers an increase in intracellular Ca(2+) in the erythrocyte (PubMed:28409866). This essential step leads to a rearrangement of the erythrocyte cytoskeleton required for the merozoite invasion (PubMed:28409866)..; FUNCTION: [Isoform 2]: (Microbial infection) Can facilitate human SARS coronavirus (SARS-CoV-1) infection via its interaction with virus-associated PPIA/CYPA..; FUNCTION: [Isoform 2]: (Microbial infection) Can facilitate HIV-1 infection via its interaction with virus-associated PPIA/CYPA..; FUNCTION: [Isoform 2]: (Microbial infection) First described as a receptor for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), it is not required for SARS-CoV-2 infection..; FUNCTION: [Isoform 2]: (Microbial infection) Acts as a receptor for measles virus..; FUNCTION: [Isoform 2]: (Microbial infection) Promotes entry of pentamer-expressing human cytomegalovirus (HCMV) into epithelial and endothelial cells..
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2742
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human