Antibodies
Anti-CD147 Antibody-Oligo Conjugate (ARC2742)
SKU: aoc1486
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD147 Antibody (ARC2742)-IF1
Antibody Target
- Target
- Basigin
- UniProt Number
- P35613
- Target Description
- [Isoform 1]: Essential for normal retinal maturation and development. Acts as a retinal cell surface receptor for NXNL1 and plays an important role in NXNL1-mediated survival of retinal cone photoreceptors. In association with glucose transporter SLC16A1/GLUT1 and NXNL1, promotes retinal cone survival by enhancing aerobic glycolysis and accelerating the entry of glucose into photoreceptors. May act as a potent stimulator of IL6 secretion in multiple cell lines that include monocytes.; FUNCTION: [Isoform 1]: (Microbial infection) Erythrocyte receptor for P.falciparum RH5 which is essential for erythrocyte invasion by the merozoite stage of P.falciparum isolates 3D7 and Dd2.; FUNCTION: [Isoform 2]: Signaling receptor for cyclophilins, essential for PPIA/CYPA and PPIB/CYPB-dependent signaling related to chemotaxis and adhesion of immune cells. Plays an important role in targeting monocarboxylate transporters SLC16A1/GLUT1, SLC16A11 and SLC16A12 to the plasma membrane. Acts as a coreceptor for vascular endothelial growth factor receptor 2 (KDR/VEGFR2) in endothelial cells enhancing its VEGFA-mediated activation and downstream signaling. Promotes angiogenesis through EPAS1/HIF2A-mediated up-regulation of VEGFA (isoform VEGF-165 and VEGF-121) and KDR/VEGFR2 in endothelial cells. Plays a key role in regulating tumor growth, invasion, metastasis and neoangiogenesis by stimulating the production and release of extracellular matrix metalloproteinases and KDR/VEGFR2 by both tumor cells and stromal cells (fibroblasts and endothelial cells).; FUNCTION: [Isoform 2]: (Microbial infection) Erythrocyte receptor for P.falciparum RH5 which is essential for erythrocyte invasion by the merozoite stage of P.falciparum isolates 3D7, Dd2, 7G8 and HB3. Binding of P.falciparum RH5 results in BSG dimerization which triggers an increase in intracellular Ca(2+) in the erythrocyte. This essential step leads to a rearrangement of the erythrocyte cytoskeleton required for the merozoite invasion.; FUNCTION: [Isoform 2]: (Microbial infection) Can facilitate human SARS coronavirus (SARS-CoV-1) infection via its interaction with virus-associated PPIA/CYPA.; FUNCTION: [Isoform 2]: (Microbial infection) Can facilitate HIV-1 infection via its interaction with virus-associated PPIA/CYPA.; FUNCTION: [Isoform 2]: (Microbial infection) First described as a receptor for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), it is not required for SARS-CoV-2 infection.; FUNCTION: [Isoform 2]: (Microbial infection) Acts as a receptor for measles virus.; FUNCTION: [Isoform 2]: (Microbial infection) Promotes entry of pentamer-expressing human cytomegalovirus (HCMV) into epithelial and endothelial cells.
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2742
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human