Antibodies
Anti-CD155/PVR Antibody-Oligo Conjugate
SKU: aoc1490
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD155/PVR Antibody-IF1
Antibody Target
- Target
- Poliovirus receptor
- UniProt Number
- P15151
- Target Description
- Mediates NK cell adhesion and triggers NK cell effector functions. Binds two different NK cell receptors: CD96 and CD226. These interactions accumulates at the cell-cell contact site, leading to the formation of a mature immunological synapse between NK cell and target cell. This may trigger adhesion and secretion of lytic granules and IFN-gamma and activate cytotoxicity of activated NK cells. May also promote NK cell-target cell modular exchange, and PVR transfer to the NK cell. This transfer is more important in some tumor cells expressing a lot of PVR, and may trigger fratricide NK cell activation, providing tumors with a mechanism of immunoevasion. Plays a role in mediating tumor cell invasion and migration..; FUNCTION: (Microbial infection) Acts as a receptor for poliovirus. May play a role in axonal transport of poliovirus, by targeting virion-PVR-containing endocytic vesicles to the microtubular network through interaction with DYNLT1. This interaction would drive the virus-containing vesicle to the axonal retrograde transport..; FUNCTION: (Microbial infection) Acts as a receptor for Pseudorabies virus..; FUNCTION: (Microbial infection) Is prevented to reach cell surface upon infection by Human cytomegalovirus /HHV-5, presumably to escape immune recognition of infected cell by NK cells..
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC59175
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human