Antibodies
Anti-CD162/PSGL-1 Antibody-Oligo Conjugate (ARC55292)
SKU: aoc1495
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD162/PSGL-1 Antibody (ARC55292)-IF1
Antibody Target
- Target
- P-selectin glycoprotein ligand 1
- UniProt Number
- Q14242
- Target Description
- A SLe(x)-type proteoglycan, which through high affinity, calcium-dependent interactions with E-, P- and L-selectins, mediates rapid rolling of leukocytes over vascular surfaces during the initial steps in inflammation. Critical for the initial leukocyte capture.; FUNCTION: (Microbial infection) Acts as a receptor for enterovirus 71.
- Molecular Weight
- 43 kDa/45 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCFlow CytometryELISA
- Clone
- ARC55292
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human