Antibodies
Anti-CD166 Antibody-Oligo Conjugate
SKU: aoc1497
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD166 Antibody-IF1
Antibody Target
- Target
- CD166 antigen
- UniProt Number
- Q13740
- Target Description
- Cell adhesion molecule that mediates both heterotypic cell-cell contacts via its interaction with CD6, as well as homotypic cell-cell contacts. Promotes T-cell activation and proliferation via its interactions with CD6. Contributes to the formation and maturation of the immunological synapse via its interactions with CD6. Mediates homotypic interactions with cells that express ALCAM. Acts as a ligand for the LILRB4 receptor, enhancing LILRB4-mediated inhibition of T cell proliferation. Required for normal hematopoietic stem cell engraftment in the bone marrow. Mediates attachment of dendritic cells onto endothelial cells via homotypic interaction. Inhibits endothelial cell migration and promotes endothelial tube formation via homotypic interactions. Required for normal organization of the lymph vessel network. Required for normal hematopoietic stem cell engraftment in the bone marrow. Plays a role in hematopoiesis; required for normal numbers of hematopoietic stem cells in bone marrow. Promotes in vitro osteoblast proliferation and differentiation. Promotes neurite extension, axon growth and axon guidance; axons grow preferentially on surfaces that contain ALCAM. Mediates outgrowth and pathfinding for retinal ganglion cell axons.; FUNCTION: [Isoform 3]: Inhibits activities of membrane-bound isoforms by competing for the same interaction partners. Inhibits cell attachment via homotypic interactions. Promotes endothelial cell migration. Inhibits endothelial cell tube formation.
- Molecular Weight
- 65kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC57940
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat