Antibodies
Anti-CD166 Antibody-Oligo Conjugate
SKU: aoc1497
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-CD166 Antibody-IF1
Antibody Target
- Target
- CD166 antigen
- UniProt Number
- Q13740
- Target Description
- Cell adhesion molecule that mediates both heterotypic cell-cell contacts via its interaction with CD6, as well as homotypic cell-cell contacts (PubMed:15048703, PubMed:15496415, PubMed:16352806, PubMed:23169771, PubMed:24945728, PubMed:7760007). Promotes T-cell activation and proliferation via its interactions with CD6 (PubMed:15048703, PubMed:16352806, PubMed:24945728). Contributes to the formation and maturation of the immunological synapse via its interactions with CD6 (PubMed:15294938, PubMed:16352806). Mediates homotypic interactions with cells that express ALCAM (PubMed:15496415, PubMed:16352806). Acts as a ligand for the LILRB4 receptor, enhancing LILRB4-mediated inhibition of T cell proliferation (PubMed:29263213). Required for normal hematopoietic stem cell engraftment in the bone marrow (PubMed:24740813). Mediates attachment of dendritic cells onto endothelial cells via homotypic interaction (PubMed:23169771). Inhibits endothelial cell migration and promotes endothelial tube formation via homotypic interactions (PubMed:15496415, PubMed:23169771). Required for normal organization of the lymph vessel network. Required for normal hematopoietic stem cell engraftment in the bone marrow. Plays a role in hematopoiesis; required for normal numbers of hematopoietic stem cells in bone marrow. Promotes in vitro osteoblast proliferation and differentiation (By similarity). Promotes neurite extension, axon growth and axon guidance; axons grow preferentially on surfaces that contain ALCAM. Mediates outgrowth and pathfinding for retinal ganglion cell axons (By similarity)..; FUNCTION: [Isoform 3]: Inhibits activities of membrane-bound isoforms by competing for the same interaction partners. Inhibits cell attachment via homotypic interactions. Promotes endothelial cell migration. Inhibits endothelial cell tube formation..
- Molecular Weight
- 65kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC57940
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat